MirGeneDB

Gene name

Dmo-Novel-7-P3

Family name DMO-NOVEL-7 (all species)
MiRBase ID
Paralogues Dmo-Novel-7-P1  Dmo-Novel-7-P2  Dmo-Novel-7-P4 
Orthologues
Node of Origin (gene) D. mojavensis
Node of Origin (family) D. mojavensis
Genome context
(Dmoj_caf1)
scaffold_6308: 1299938-1300001 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UCAAUUGACGUUUGAAAUAGUCUUAUGGGUUUCGGUGUGCGGCUGUUUUGCGUGUCAUUUAAUACAUAUCGUCAAACGAGCCGAACAUCGAAAUUCAUGGGGUUAACAGCGCCUUUUAAAAGUG
Get precursor sequence
Structure
        10          20        30        40         50        60 
UCAAUUGACGUUUGAAA--  GU                 G     -|   U   UGUCAUUU 
                   UA  CUUAUGGGUUUCGGUGU CGGCU GUUU GCG        \
                   AU  GGGUACUUAAAGCUACA GCCGA CAAA UGC        A
GUGAAAAUUUUCCGCGACA  UG                 A     G^   C   UAUACAUA 
  120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Em Fe Ma Ma
Star sequence

Dmo-Novel-7-P3_5p*

MirBase accessionNone
Sequence
0- UUCGGUGUGCGGCUGUUUUGCG -22
Get sequence
Mature sequence

Dmo-Novel-7-P3_3p

MirBase accessionNone
Sequence
41- UCAAACGAGCCGAACAUCGAAAU -64
Get sequence
Seed sequenceCAAACGA