MirGeneDB

MirGeneDB ID

Cin-Mir-4127

Family name MIR-4127 (all species)
Seed ACAGCUC
Species Sea Squirt (Ciona intestinalis)
MiRBase ID cin-mir-4127
Paralogues
Orthologues
Node of Origin (locus) C. intestinalis
Node of Origin (family) C. intestinalis
Genome context
(ci3)
5: 2473269-2473324 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUGUGAAAAAUUUUUAUGGCCGUUUCAAGUGACAGCUCGCUCAGCUGGCUGUGUGAUAAUCAACAGGCAGCUGUGAGAGAAGUUGCAAGAGACGGGAACUUUCUGCUGACUUCAAA
Get precursor sequence
Structure
        10          20        30        40        50       
UUGUGAAAAAUUUUUAUGG--|      AA UG  AG   GCU      G    GUGA 
                     CCGUUUC  G  AC  CUC   CAGCUG CUGU    U
                     GGCAGAG  C  UG  GAG   GUCGAC GACA    A
AAACUUCAGUCGUCUUUCAAG^      AA GU  AA   AGU      G    ACUA 
    110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Cr Cr Cr Cr Cr Cr Cr Cr Cr Cr Ga La La
Mature sequence

Cin-Mir-4127_5p

MirBase accessionMIMAT0016721
Sequence
0- GACAGCUCGCUCAGCUGGCUGU -22
Get sequence
Star sequence

Cin-Mir-4127_3p*

MirBase accessionMIMAT0016722
Sequence
34- AGGCAGCUGUGAGAGAAGUUGC -56
Get sequence