MirGeneDB

Gene name

Bge-Novel-9-P2

Family name BGE-NOVEL-9 (all species)
MiRBase ID
Paralogues Bge-Novel-9-P1 
Orthologues
Node of Origin (gene) B. germanica
Node of Origin (family) B. germanica
Genome context
(Bger_2.0)
KZ614500.1: 82175-82234 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
ACAUCGAUAUGGGGAAAGAGGUUCAUGCCAUACGAUAAUGUCUGUGGCUCAGAUUGGUGUAUAAAUUCUGACCGUGGACAAUAUGGUACUGAAUGAGCUUUAAUGGCACAAGUAUAAUCC
Get precursor sequence
Structure
        10          20        30         40        50          
ACAUCGAUAUGGGGAAA--|        GC  -   G   A    UG   C     UUGGUG 
                   GAGGUUCAU  CA UAC AUA UGUC  UGG UCAGA      \
                   UUUCGAGUA  GU AUG UAU ACAG  GCC AGUCU      U
CCUAAUAUGAACACGGUAA^        A-  C   G   A    GU   -     UAAAUA 
.       110       100         90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Ad Ad Ny Ny Ny Ny Ny Ny Ny Ny Ov Co Co Em Em Em Em Em Em Em Em Em Em No No
Mature sequence

Bge-Novel-9-P2_5p

MirBase accessionNone
Sequence
0- UACGAUAAUGUCUGUGGCUCAGA -23
Get sequence
Seed sequenceACGAUAA
Star sequence

Bge-Novel-9-P2_3p*

MirBase accessionNone
Sequence
38- UGACCGUGGACAAUAUGGUACU -60
Get sequence