MirGeneDB

Gene name

Bge-Novel-14

Family name BGE-NOVEL-14 (all species)
MiRBase ID
Paralogues
Orthologues
Node of Origin (gene) B. germanica
Node of Origin (family) B. germanica
Genome context
(Bger_2.0)
KZ617118.1: 382632-382690 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGCUAUGGAAUUUUUGUGUCGGGCAUCAACAGCGGCAAGGUCUGGAGUGAAGUUUUCAAAGUAAUCUUGACUCCAGACCUUGUUGCUGAUGACGUCUGUCAUAGACAUCUUGAAUUUUA
Get precursor sequence
Structure
        10          20        30        40        50         
AGCUAUGGAAUUUUUGU--|U     A   A                   G   UUUUCA 
                   G CGGGC UCA CAGCGGCAAGGUCUGGAGU AAG      \
                   C GUCUG AGU GUCGUUGUUCCAGACCUCA UUC      A
AUUUUAAGUUCUACAGAUA^U     C   A                   G   UAAUGA 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Ad Ad Ny Ny Ny Ny Ny Ny Ny Ny Ov Co Co Em Em Em Em Em Em Em Em Em Em No No
Star sequence

Bge-Novel-14_5p*

MirBase accessionNone
Sequence
0- AGCGGCAAGGUCUGGAGUGAAG -22
Get sequence
Mature sequence

Bge-Novel-14_3p

MirBase accessionNone
Sequence
37- UGACUCCAGACCUUGUUGCUGA -59
Get sequence
Seed sequenceGACUCCA