MirGeneDB

MirGeneDB ID

Asu-Mir-5357

Family name MIR-5357 (all species)
Seed AUGGACA
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-5357
Paralogues
Orthologues
Node of Origin (locus) A. suum
Node of Origin (family) A. suum
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold420: 529272-529329 [-]
Precursor
(pre-Mir +30nt flank)
ACGCCGCUCUCACCCUUCUACUCGACUCCUCACCCGAAUCGUUGUUCAUUUGUAUUGCUUGCCUCAAAUGGACAACGAUUUGGGUGAGGAGUUGAGCAGAAUUAUCUCCAGUGAGAUA
Get precursor sequence
Structure
        10          20        30        40        50        
ACGCCGCUCUCACCCUU--| A                                UAUUG 
                   CU CUCGACUCCUCACCCGAAUCGUUGUUCAUUUG     C
                   GA GAGUUGAGGAGUGGGUUUAGCAACAGGUAAAC     U
AUAGAGUGACCUCUAUUAA^ C                                UCCGU 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Star sequence

Asu-Mir-5357_5p*

MirBase accessionMIMAT0021576
Sequence
0- CACCCGAAUCGUUGUUCAUUUG -22
Get sequence
Mature sequence

Asu-Mir-5357_3p

MirBase accessionMIMAT0021577
Sequence
36- AAUGGACAACGAUUUGGGUGAG -58
Get sequence