MirGeneDB

MirGeneDB ID

Asu-Mir-5355

Family name MIR-5355 (all species)
Seed GAACACC
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-5355
Paralogues
Orthologues
Node of Origin (locus) A. suum
Node of Origin (family) A. suum
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold144: 78567-78627 [-]
Precursor
(pre-Mir +30nt flank)
UAUAUCGCCCUUUAUUCUGCACACCGAUUCUGAACACCUCAAGAGAUACAACGCUGUUAUUGGUAACGGUGUGCCCCUUGAGGUGUUUAGAAUGAUGGUGUAUACACAUUGAACGUCUCGA
Get precursor sequence
Structure
        10        20          30        40        50          
UAUAUCGCCCUUUAUUCUGC      --|                AGA    A  CUGUUA 
                    ACACCG  AUUCUGAACACCUCAAG   UACA CG      \
                    UGUGGU  UAAGAUUUGUGGAGUUC   GUGU GC      U
AGCUCUGCAAGUUACACAUA      AG^                CCC    G  AAUGGU 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Mature sequence

Asu-Mir-5355_5p

MirBase accessionMIMAT0021570
Sequence
0- UGAACACCUCAAGAGAUACAACG -23
Get sequence
Star sequence

Asu-Mir-5355_3p*

MirBase accessionMIMAT0021571
Sequence
38- GUGUGCCCCUUGAGGUGUUUAGA -61
Get sequence