MirGeneDB

MirGeneDB ID

Asu-Mir-5342

Family name MIR-5342 (all species)
Seed AAUAUCA
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-5342
Paralogues
Orthologues
Node of Origin (locus) A. suum
Node of Origin (family) A. suum
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold122: 2401266-2401323 [-]
Precursor
(pre-Mir +30nt flank)
UGAUUCCAGAAGCGCUGACUUGAGUGCAUUACUCGUCAACCAGUAAUAUUAUGUUUUAAUGACCAUAAUAUCACUGGCUUACGGGAAAUGGCCUUUGGUCCCUAUGCUUCACAUGUGC
Get precursor sequence
Structure
        10          20        30        40        50        
UGAUUCCAGAAGCGCUG--|  U   UG    A     CAA     A        UUUU 
                   ACU GAG  CAUU CUCGU   CCAGU AUAUUAUG    A
                   UGG UUC  GUAA GGGCA   GGUCA UAUAAUAC    A
CGUGUACACUUCGUAUCCC^  U   CG    A     UUC     C        CAGU 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Star sequence

Asu-Mir-5342_5p*

MirBase accessionMIMAT0021517
Sequence
0- ACUCGUCAACCAGUAAUAUUAUG -23
Get sequence
Mature sequence

Asu-Mir-5342_3p

MirBase accessionMIMAT0021518
Sequence
35- UAAUAUCACUGGCUUACGGGAAA -58
Get sequence