MirGeneDB

MirGeneDB ID

Asu-Mir-22-P2

Family name MIR-22 (all species)
Seed AGCUGCC
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-1822
Paralogues
Orthologues Aae-Mir-22-P2  Bge-Mir-22-P2  Cbr-Mir-22-P2-v1  Cbr-Mir-22-P2-v2  Cel-Mir-22-P2  Cgi-Mir-22-P2  Cte-Mir-22-P2  Dan-Mir-22-P2  Dme-Mir-22-P2  Dmo-Mir-22-P2  Dpu-Mir-22-P2  Hme-Mir-22-P2  Lan-Mir-22-P2  Lgi-Mir-22-P2  Tca-Mir-22-P2-v1  Tca-Mir-22-P2-v2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold1417: 35061-35121 [-]
Precursor
(pre-Mir +30nt flank)
UUAAAGCUAUACUGCUUGCUUCCUAGCGUACGUCUUUCAUUCGGUUCAGCUAUCGGUGAAUUUCGCUCCGAGCUGCCCUAUGAAGGACUGUCGCUAUUACGCUUUUCCACCCUACUCUAUC
Get precursor sequence
Structure
        10          20        30         40        50        60  
UUAAAGCUAUACUGCUU--| UUCC     U  -         UC  UU    UA    UGAAU 
                   GC    UAGCG AC GUCUUUCAU  GG  CAGC  UCGG     \
                   CG    AUCGC UG CAGGAAGUA  CC  GUCG  AGCC     U
CUAUCUCAUCCCACCUUUU^ CAUU     -  U         UC  --    --    UCGCU 
 .       110       100         90        80            70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Star sequence

Asu-Mir-22-P2_5p*

MirBase accessionMIMAT0021535
Sequence
0- CGUCUUUCAUUCGGUUCAGCUAUCGG -26
Get sequence
Mature sequence

Asu-Mir-22-P2_3p

MirBase accessionMIMAT0021536
Sequence
39- GAGCUGCCCUAUGAAGGACUGU -61
Get sequence