MirGeneDB

Gene name

Aae-Iab-4-P1

Family name IAB-4 (all species)
MiRBase ID aae-mir-iab-4-1
Paralogues Aae-Iab-4-P2 
Orthologues Isc-Iab-4 
Node of Origin (gene) A. aegypti
Node of Origin (family) Arthropoda
Genome context
(Aaeg_L3)
supercont1.708: 50265-50321 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AUACUUCGUUGCUCACGUACUGCUUCAUGAACGUAUACUGAAUGUAUCCUGAGUGCUAUCUAUCCGGUAUACCUUCAGUAUACGUAACAGGAGGCUGCACAAUCAUCUUUAGUCGGG
Get precursor sequence
Structure
        10        20         30         40         50       
AUACUUCGUUGCUCACGUACU-     A  A-            U    -| U  GUGC 
                      GCUUC UG  ACGUAUACUGAA GUAU CC GA    U
                      CGGAG AC  UGCAUAUGACUU CAUA GG CU    A
GGGCUGAUUUCUACUAACACGU     G  AA            C    U^ C  AUCU 
     110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Fe Fe Fe Fe To To To
Mature sequence

Aae-Iab-4-P1_5p

MirBase accessionMIMAT0014278
Sequence
0- ACGUAUACUGAAUGUAUCCUGA -22
Get sequence
Seed sequenceCGUAUAC
Star sequence

Aae-Iab-4-P1_3p*

MirBase accessionMIMAT0016977
Sequence
34- CGGUAUACCUUCAGUAUACGUAA -57
Get sequence