MirGeneDB

MirGeneDB ID

Xtr-Mir-23-P1

Family name MIR-23 (all species)
Seed UCACAUU
Species Tropical clawed frog (Xenopus tropicalis)
MiRBase ID xtr-mir-23a-1
Paralogues Xtr-Mir-23-P2  Xtr-Mir-23-P3 
Orthologues Aca-Mir-23-P1  Ami-Mir-23-P1  Bta-Mir-23-P1  Cfa-Mir-23-P1  Cpi-Mir-23-P1  Cpo-Mir-23-P1  Dno-Mir-23-P1  Dre-Mir-23-P1  Ete-Mir-23-P1  Hsa-Mir-23-P1  Mdo-Mir-23-P1  Mml-Mir-23-P1  Mmu-Mir-23-P1  Oan-Mir-23-P1  Rno-Mir-23-P1  Sha-Mir-23-P1  Sto-Mir-23-o1  Sto-Mir-23-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(xenTro7)
KB021698: 51445-51508 [+] UCSC
Clustered MiRNAs
(< 10kb from Mir-23-P1)
Mir-23-P1 KB021698: 51445-51508 [+] UCSC
Mir-27-P1 KB021698: 52053-52114 [+] UCSC
Mir-24-P1 KB021698: 52185-52244 [+] UCSC
Precursor
(pre-Mir +30nt flank)
CCCCGUGGGCCCUUCUUGCUGCUGACAGCGGGGGAUUCCUGGAGAUGGGAUUUUAUUUUGGCAGCCAAUAAAUCACAUUGCCAGGGAUUUCCAACUGUCGGCCGCCCGGUCAGCGGCGCAACUU
Get precursor sequence
Structure
        10          20        30        40        50        60 
CCCCGUGGGCCCUUCUU--| U        CG  GG        AG   G     UAUUUUG 
                   GC GCUGACAG  GG  AUUCCUGG  AUG GAUUU       G
                   CG CGGCUGUC  CC  UAGGGACC  UAC CUAAA       C
UUCAACGCGGCGACUGGCC^ C        AA  UU        GU   A     UAACCGA 
  120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Br Em Em Em Em He
Star sequence

Xtr-Mir-23-P1_5p*

MirBase accessionNone
Sequence
0- GGGGAUUCCUGGAGAUGGGAUUU -23
Get sequence
Mature sequence

Xtr-Mir-23-P1_3p

MirBase accessionMIMAT0003568
Sequence
41- AUCACAUUGCCAGGGAUUUCCAA -64
Get sequence
Validated targets TargetScanVert: xtr-miR-23a