MirGeneDB

MirGeneDB ID

Xtr-Mir-205-P3

Family name MIR-205 (all species)
Seed CCUUCAU
Species Tropical clawed frog (Xenopus tropicalis)
MiRBase ID xtr-mir-205b
Paralogues Xtr-Mir-205-P1 
Orthologues Sto-Mir-205-P3 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(xenTro7)
KB021653: 120494493-120494552 [-] UCSC
Precursor
(pre-Mir +30nt flank)
CACUUGCCGUCUGAAGGGCCCCUGCUGCUGUCCUUCAUUCCACCGGAUCCUGUGUAAAUAUAAUCCAGAUUCCCAGUGGCAUGAAGUGCAUUAGCUGAGCCUGUGAGCACCUACCAAGGG
Get precursor sequence
Structure
        10           20        30        40         50         
CACUUGCCGUCUGAAGG---| CCCU    C  UC      U    C-   UC  GUGUAAA 
                    GC    GCUG UG  CUUCAU CCAC  GGA  CU       \
                    CG    CGAU AC  GAAGUA GGUG  CCU  GA       U
GGGAACCAUCCACGAGUGUC^ AGU-    U  GU      C    AC   UA  CCUAAUA 
.       110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Br Em Em Em Em He
Mature sequence

Xtr-Mir-205-P3_5p

MirBase accessionMIMAT0003622
Sequence
0- UCCUUCAUUCCACCGGAUCCU -21
Get sequence
Validated targets TargetScanVert: xtr-miR-205b
Star sequence

Xtr-Mir-205-P3_3p*

MirBase accessionNone
Sequence
38- AUUCCCAGUGGCAUGAAGUGCA -60
Get sequence