MirGeneDB

MirGeneDB ID

Xtr-Mir-199-P3-v2

Family name MIR-199 (all species)
Seed ACAGUAG
Species Tropical clawed frog (Xenopus tropicalis)
MiRBase ID xtr-mir-199a
Paralogues Xtr-Mir-199-P2  Xtr-Mir-199-P3-v1  Xtr-Mir-199-P3-v3 
Orthologues Aca-Mir-199-P3-v1  Aca-Mir-199-P3-v2  Aca-Mir-199-P3-v3  Ami-Mir-199-P3-v1  Ami-Mir-199-P3-v2  Ami-Mir-199-P3-v3  Bta-Mir-199-P3-v1  Bta-Mir-199-P3-v2  Bta-Mir-199-P3-v3  Cfa-Mir-199-P3-v1  Cfa-Mir-199-P3-v2  Cfa-Mir-199-P3-v3  Cli-Mir-199-P3-v1  Cli-Mir-199-P3-v2  Cli-Mir-199-P3-v3  Cpi-Mir-199-P3-v1  Cpi-Mir-199-P3-v2  Cpi-Mir-199-P3-v3  Cpo-Mir-199-P3-v1  Cpo-Mir-199-P3-v2  Cpo-Mir-199-P3-v3  Dno-Mir-199-P3-v1  Dno-Mir-199-P3-v2  Dno-Mir-199-P3-v3  Dre-Mir-199-P3-v1  Dre-Mir-199-P3-v2  Dre-Mir-199-P3-v3  Ete-Mir-199-P3-v1  Ete-Mir-199-P3-v2  Ete-Mir-199-P3-v3  Gga-Mir-199-P3-v1  Gga-Mir-199-P3-v2  Gga-Mir-199-P3-v3  Hsa-Mir-199-P3-v1  Hsa-Mir-199-P3-v2  Hsa-Mir-199-P3-v3  Mdo-Mir-199-P3-v1  Mdo-Mir-199-P3-v2  Mdo-Mir-199-P3-v3  Mml-Mir-199-P3-v1  Mml-Mir-199-P3-v2  Mml-Mir-199-P3-v3  Mmu-Mir-199-P3-v1  Mmu-Mir-199-P3-v2  Mmu-Mir-199-P3-v3  Oan-Mir-199-P3-v1  Oan-Mir-199-P3-v2  Oan-Mir-199-P3-v3  Ocu-Mir-199-P3-v1  Ocu-Mir-199-P3-v2  Ocu-Mir-199-P3-v3  Rno-Mir-199-P3-v1  Rno-Mir-199-P3-v2  Rno-Mir-199-P3-v3  Sha-Mir-199-P3-v1  Sha-Mir-199-P3-v2  Sha-Mir-199-P3-v3  Sto-Mir-199-P3-v1  Sto-Mir-199-P3-v2  Sto-Mir-199-P3-v3  Tgu-Mir-199-P3-v1  Tgu-Mir-199-P3-v2  Tgu-Mir-199-P3-v3 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(xenTro7)
KB021653: 70171814-70171874 [+] UCSC
Clustered MiRNAs
(< 10kb from Mir-199-P3-v2)
Mir-199-P3-v1 KB021653: 70171814-70171874 [+] UCSC
Mir-199-P3-v2 KB021653: 70171814-70171874 [+] UCSC
Mir-199-P3-v3 KB021653: 70171814-70171874 [+] UCSC
Mir-214-v1 KB021653: 70176927-70176989 [+] UCSC
Mir-214-v2 KB021653: 70176927-70176989 [+] UCSC
Precursor
(pre-Mir +30nt flank)
CAAUGUUUCGGAAAGAACCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAAUGCUGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAUGGGACAGCAACGACAUGGAU
Get precursor sequence
Structure
        10          20        30        40        50        60
CAAUGUUUCGGAAAGAA-  -|    C   GCC       U        C   U  GGACA 
                  CC UGCUC GUC   CCAGUGU CAGACUAC UGU CA     A
                  GG ACGGG CAG   GGUUACA GUCUGAUG ACA GU     U
UAGGUACAGCAACGACAG  U^    U   AUU       C        -   U  UGUCG 
 .       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Em Em Em Em He
Star sequence

Xtr-Mir-199-P3-v2_5p*

MirBase accessionMIMAT0003618
Sequence
0- CCCAGUGUUCAGACUACCUGUUCA -24
Get sequence
Validated targets TargetScanVert: xtr-miR-199a-5p
Mature sequence

Xtr-Mir-199-P3-v2_3p

MirBase accessionMIMAT0003619
Sequence
38- UACAGUAGUCUGCACAUUGGUUA -61
Get sequence
Validated targets TargetScanVert: xtr-miR-199a-3p