MirGeneDB

MirGeneDB ID

Xtr-Mir-19-P2b

Family name MIR-19 (all species)
Seed GUGCAAA
Species Tropical clawed frog (Xenopus tropicalis)
MiRBase ID xtr-mir-19b-1
Paralogues Xtr-Mir-19-P1  Xtr-Mir-19-P2a 
Orthologues Aca-Mir-19-P2b  Bta-Mir-19-P2b  Cfa-Mir-19-P2b  Cli-Mir-19-P2b  Cpi-Mir-19-P2b  Cpo-Mir-19-P2b  Dno-Mir-19-P2b  Dre-Mir-19-P2b1  Ete-Mir-19-P2b  Gga-Mir-19-P2b  Hsa-Mir-19-P2b  Mdo-Mir-19-P2b  Mml-Mir-19-P2b  Mmu-Mir-19-P2b  Oan-Mir-19-P2b  Ocu-Mir-19-P2b  Rno-Mir-19-P2b  Sha-Mir-19-P2b  Sto-Mir-19-P2b  Tgu-Mir-19-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(xenTro7)
KB021658: 46973363-46973419 [-] UCSC
Clustered MiRNAs
(< 10kb from Mir-19-P2b)
Mir-92-P2b KB021658: 46973102-46973166 [-] UCSC
Mir-92-P1b KB021658: 46973232-46973290 [-] UCSC
Mir-19-P2b KB021658: 46973363-46973419 [-] UCSC
Mir-17-P3b KB021658: 46973476-46973535 [-] UCSC
Mir-17-P2b KB021658: 46973632-46973696 [-] UCSC
Mir-17-P1b KB021658: 46973757-46973813 [-] UCSC
Precursor
(pre-Mir +30nt flank)
GCUUGGUGACUAUAGAUACCUGCUCCUGUCAGUUUAGCUGGUUUGCAUCAGCUGACUAUUGUGCUGUGCAAAUCCAUGCAAAACUGACUGUGGCUGGGAAGGCUCUCUGGAAUUGCU
Get precursor sequence
Structure
        10          20        30         40         50       
GCUUGGUGACUAUAGAUA--  U   CCU        A  -   -|     U    UGAC 
                    CC GCU   GUCAGUUU GC UGG UUUGCA CAGC    U
                    GG CGG   CAGUCAAA CG ACC AAACGU GUCG    A
UCGUUAAGGUCUCUCGGAAG  U   UGU        A  U   U^     -    UGUU 
     110       100        90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Em Em Em Em He
Star sequence

Xtr-Mir-19-P2b_5p*

MirBase accessionNone
Sequence
0- AGUUUAGCUGGUUUGCAUCAGC -22
Get sequence
Mature sequence

Xtr-Mir-19-P2b_3p

MirBase accessionMIMAT0003567
Sequence
34- UGUGCAAAUCCAUGCAAAACUGA -57
Get sequence
Validated targets TargetScanVert: xtr-miR-19b