MirGeneDB

MirGeneDB ID

Xtr-Mir-130-P3b

Family name MIR-130 (all species)
Seed AGUGCAA
Species Tropical clawed frog (Xenopus tropicalis)
MiRBase ID xtr-mir-130c
Paralogues Xtr-Mir-130-P1b  Xtr-Mir-130-P2a  Xtr-Mir-130-P2b  Xtr-Mir-130-P3a  Xtr-Mir-130-P4b 
Orthologues Aca-Mir-130-P3b  Ami-Mir-130-P3b  Cli-Mir-130-P3b  Cpi-Mir-130-P3b  Dre-Mir-130-P3b1  Dre-Mir-130-P3b2  Gga-Mir-130-P3b  Oan-Mir-130-P3b  Sto-Mir-130-P3b  Tgu-Mir-130-P3b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(xenTro7)
KB021649: 54026004-54026062 [+] UCSC
Clustered MiRNAs
(< 10kb from Mir-130-P3b)
Mir-130-P3b KB021649: 54026004-54026062 [+] UCSC
Mir-130-P2b KB021649: 54026845-54026905 [+] UCSC
Mir-130-P1b KB021649: 54034847-54034906 [+] UCSC
Precursor
(pre-Mir +30nt flank)
UGUGGAAAGACGUGGAACCUGUUAUCCGUGGCCCUUUUUCUGUUGUACUACUGGAAUUUGUAAUUAGCAGUGCAAUAUUAAAAGGGCAUUGGCUGACAGAACCCUAACACAACUUAAUA
Get precursor sequence
Structure
        10          20        30        40        50         
UGUGGAAAGACGUGGAAC--|     U   UG        UC         A  GGAAUU 
                    CUGUUA CCG  GCCCUUUU  UGUUGUACU CU      \
                    GACAGU GGU  CGGGAAAA  AUAACGUGA GA      U
AUAAUUCAACACAAUCCCAA^     C   UA        UU         C  UUAAUG 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Em Em Em Em He
Star sequence

Xtr-Mir-130-P3b_5p*

MirBase accessionNone
Sequence
0- GCCCUUUUUCUGUUGUACUACU -22
Get sequence
Mature sequence

Xtr-Mir-130-P3b_3p

MirBase accessionMIMAT0003592
Sequence
37- CAGUGCAAUAUUAAAAGGGCAU -59
Get sequence
Validated targets TargetScanVert: xtr-miR-130c