MirGeneDB

MirGeneDB ID

Xtr-Mir-126-v1

Family name MIR-126 (all species)
Seed AUUAUUA
Species Tropical clawed frog (Xenopus tropicalis)
MiRBase ID xtr-mir-126
Paralogues Xtr-Mir-126-v2  Xtr-Mir-126-v3 
Orthologues Aca-Mir-126-v1  Ami-Mir-126-v1  Bta-Mir-126-v1  Cfa-Mir-126-v1  Cin-Mir-126-v1  Cli-Mir-126-v1  Cpi-Mir-126-v1  Cpo-Mir-126-v1  Dno-Mir-126-v1  Ete-Mir-126-v1  Gga-Mir-126-v1  Hsa-Mir-126-v1  Mdo-Mir-126-v1  Mml-Mir-126-v1  Mmu-Mir-126-v1  Oan-Mir-126-v1  Ocu-Mir-126-v1  Rno-Mir-126-v1  Sha-Mir-126-v1  Sto-Mir-126-v1  Tgu-Mir-126-v1 
Node of Origin (locus) Olfactores
Node of Origin (family) Olfactores
Genome context
(xenTro7)
KB021658: 10074233-10074291 [-] UCSC
Clustered MiRNAs
(< 10kb from Mir-126-v1)
Mir-126-v1 KB021658: 10074233-10074291 [-] UCSC
Mir-126-v2 KB021658: 10074233-10074291 [-] UCSC
Mir-126-v3 KB021658: 10074233-10074291 [-] UCSC
Precursor
(pre-Mir +30nt flank)
AGACCGCCGCGCAGAAGGUUGGUGGCUGUGCAUUAUUACUUUUGGUACGCGCUGUGUCACAUCAAACUCGUACCGUGAGUAAUAAUGCGCAGCUGCCAAUAAUGCCGACAAGGAUGCUC
Get precursor sequence
Structure
        10          20        30        40        50         
AGACCGCCGCGCAGAAG--|    UG                 U       CGCUGUGUC 
                   GUUGG  GCUGUGCAUUAUUACUU UGGUACG         \
                   UAACC  CGACGCGUAAUAAUGAG GCCAUGC         A
CUCGUAGGAACAGCCGUAA^    GU                 U       UCAAACUAC 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Em Em Em Em He
Mature sequence

Xtr-Mir-126-v1_5p

MirBase accessionMIMAT0003587
Sequence
0- CAUUAUUACUUUUGGUACGCG -21
Get sequence
Validated targets TargetScanVert: xtr-miR-126-5p
Star sequence

Xtr-Mir-126-v1_3p*

MirBase accessionMIMAT0003588
Sequence
38- CGUACCGUGAGUAAUAAUGCG -59
Get sequence
Validated targets TargetScanVert: xtr-miR-126-3p