MirGeneDB

MirGeneDB ID

Tgu-Mir-205-P1a

Family name MIR-205 (all species)
Seed CCUUCAU
Species Zebra finch (Taeniopygia guttata)
MiRBase ID
Paralogues Tgu-Mir-205-P1b  Tgu-Mir-205-P2 
Orthologues Aca-Mir-205-P1  Ami-Mir-205-P1  Bta-Mir-205-P1  Cfa-Mir-205-P1  Cli-Mir-205-P1  Cpi-Mir-205-P1  Cpo-Mir-205-P1  Dno-Mir-205-P1  Dre-Mir-205-P1  Ete-Mir-205-P1  Gga-Mir-205-P1  Hsa-Mir-205-P1  Mdo-Mir-205-P1  Mml-Mir-205-P1  Mmu-Mir-205-P1  Oan-Mir-205-P1  Ocu-Mir-205-P1  Rno-Mir-205-P1  Sha-Mir-205-P1  Sto-Mir-205-P1  Xtr-Mir-205-P1 
Node of Origin (locus) T. guttata
Node of Origin (family) Vertebrata
Genome context
(taeGut3.2.4)
26: 3385298-3385355 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GGGAGCGAGGACCAUCCAUGGGUUCUGUUGUCCUUCAUUCCACCGGAGUCUGUCUCUAGCUAACCAGAUUUCAGUGGAGUGAAGCACAAGAGGCAUGGAGCUGAGCNNNNNNNNNNNN
Get precursor sequence
Structure
        10        20           30        40        50        
GGGAGCGAGGACCAUCCAUGG---| U  G    C           C        UCUCU 
                        GU CU UUGU CUUCAUUCCAC GGAGUCUG     A
                        CG GA AACA GAAGUGAGGUG CUUUAGAC     G
NNNNNNNNNNNNCGAGUCGAGGUA^ -  G    C           A        CAAUC 
      110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Fe Fe Fe Fe Ma Ma Ma Ma
Mature sequence

Tgu-Mir-205-P1a_5p

MirBase accessionNone
Sequence
0- UCCUUCAUUCCACCGGAGUCUG -22
Get sequence
Star sequence

Tgu-Mir-205-P1a_3p*

MirBase accessionNone
Sequence
36- GAUUUCAGUGGAGUGAAGCACA -58
Get sequence