MirGeneDB

MirGeneDB ID

Tgu-Mir-204-P3a

Family name MIR-204 (all species)
Seed UCCCUUU
Species Zebra finch (Taeniopygia guttata)
MiRBase ID tgu-mir-204-3
Paralogues Tgu-Mir-204-P1  Tgu-Mir-204-P2  Tgu-Mir-204-P3b 
Orthologues Ami-Mir-204-P3  Cli-Mir-204-P3  Cpi-Mir-204-P3  Gga-Mir-204-P3  Sto-Mir-204-P3 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(taeGut3.2.4)
28: 1367983-1368040 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-204-P3a)
Mir-204-P3b 28: 1366351-1366408 [-] UCSC Ensembl
Mir-204-P3a 28: 1367983-1368040 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCAGGCCCGGGCCCGCUGCCCCCUGUGAGCUUCCCUUUGUCAUCCUAUGCCUGAGCGAUGCCUGGAGGCUGGGACGGCCAAGGGAGGCCCACGGGCUGCCACCCACAGCCCCGCGGUG
Get precursor sequence
Structure
        10          20        30        40        50         
GCAGGCCCGGGCCCGCU--| CC      A         U   A     U    GAGCGA 
                   GC  CCUGUG GCUUCCCUU GUC UCCUA GCCU      \
                   CG  GGGCAC CGGAGGGAA CGG AGGGU CGGA      U
GUGGCGCCCCGACACCCAC^ UC      C         C   C     -    GGUCCG 
      110       100        90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Fe Fe Fe Fe Ma Ma Ma Ma
Mature sequence

Tgu-Mir-204-P3a_5p

MirBase accessionMIMAT0014570
Sequence
0- UUCCCUUUGUCAUCCUAUGCCU -22
Get sequence
Star sequence

Tgu-Mir-204-P3a_3p* (predicted)

MirBase accessionNone
Sequence
37- GCUGGGACGGCCAAGGGAGGC -58
Get sequence