MirGeneDB

MirGeneDB ID

Tgu-Mir-19-P2b

Family name MIR-19 (all species)
Seed GUGCAAA
Species Zebra finch (Taeniopygia guttata)
MiRBase ID tgu-mir-19b-2
Paralogues Tgu-Mir-19-P1  Tgu-Mir-19-P2a 
Orthologues Aca-Mir-19-P2b  Bta-Mir-19-P2b  Cfa-Mir-19-P2b  Cli-Mir-19-P2b  Cpi-Mir-19-P2b  Cpo-Mir-19-P2b  Dno-Mir-19-P2b  Dre-Mir-19-P2b1  Ete-Mir-19-P2b  Gga-Mir-19-P2b  Hsa-Mir-19-P2b  Mdo-Mir-19-P2b  Mml-Mir-19-P2b  Mmu-Mir-19-P2b  Oan-Mir-19-P2b  Ocu-Mir-19-P2b  Rno-Mir-19-P2b  Sha-Mir-19-P2b  Sto-Mir-19-P2b  Xtr-Mir-19-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(taeGut3.2.4)
4A: 7274227-7274286 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-19-P2b)
Mir-17-P1b 4A: 7273756-7273813 [+] UCSC Ensembl
Mir-17-P3b 4A: 7274102-7274162 [+] UCSC Ensembl
Mir-19-P2b 4A: 7274227-7274286 [+] UCSC Ensembl
Mir-92-P1b 4A: 7274424-7274485 [+] UCSC Ensembl
Mir-92-P2b 4A: 7274563-7274627 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUGCUGGAGAAGUUGGUGCUGAUUACAGUCAGUUUUGCAGGUUUGCAUCCCAGCUUACUAAAAUUGCUGUGCAAAUCCAUGCAAAACUGACUGUGGUGGUGGUGAAUCUGUGGUGAAUAA
Get precursor sequence
Structure
        10           20        30         40         50          
UUGCUGGAGAAGUUGGU---   G                  -  -|     UCC    UUACU 
                    GCU AUUACAGUCAGUUUUGCA GG UUUGCA   CAGC     \
                    UGG UGGUGUCAGUCAAAACGU CC AAACGU   GUCG     A
AAUAAGUGGUGUCUAAGUGG   -                  A  U^     ---    UUAAA 
.       110       100         90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Fe Fe Fe Fe Ma Ma Ma Ma
Star sequence

Tgu-Mir-19-P2b_5p*

MirBase accessionMIMAT0031102
Sequence
0- AGUUUUGCAGGUUUGCAUCCCAGC -24
Get sequence
Mature sequence

Tgu-Mir-19-P2b_3p

MirBase accessionMIMAT0014517
Sequence
37- UGUGCAAAUCCAUGCAAAACUGA -60
Get sequence