MirGeneDB

MirGeneDB ID

Tca-Mir-279-o25

Family name MIR-279 (all species)
Seed GACUAGA
Species Red flour beetle (Tribolium castaneum)
MiRBase ID tca-mir-279e
Paralogues Tca-Mir-279-o21  Tca-Mir-279-o22  Tca-Mir-279-o23  Tca-Mir-279-o24 
Orthologues Cgi-Mir-279  Isc-Mir-279  Lgi-Mir-279 
Node of Origin (locus) T. castaneum
Node of Origin (family) Protostomia
Genome context
(Tcas5.2)
LG9: 11214-11274 [-] Ensembl
Clustered MiRNAs
(< 10kb from Mir-279-o25)
Mir-2-P10c LG9: 10977-11036 [-] Ensembl
Mir-279-o25 LG9: 11214-11274 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
ACCUUGCUUUCGGUGGAGCUCUCGGUGUAAGCCAGUGUUCAGUCUAUUGUUUCACAUUGGUUUCGAUUGUGACUAGAUCGAACACUCGCUUGCAACCUGGGUUUGGUCAGCGCUGCUACUU
Get precursor sequence
Structure
        10          20         30        40        50        60  
ACCUUGCUUUCGGUGGA--|   UC   -      C       A     UUGUU     UUGGU 
                   GCUC  GGU GUAAGC AGUGUUC GUCUA     UCACA     \
                   UGGG  CCA CGUUCG UCACAAG UAGAU     AGUGU     U
UUCAUCGUCGCGACUGGUU^   U-   A      C       C     C----     UAGCU 
 .       110       100         90        80            70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Ea Em Em Em Em Em Fe Fe Fe Fe Oo
Star sequence

Tca-Mir-279-o25_5p*

MirBase accessionMIMAT0018816
Sequence
0- GCCAGUGUUCAGUCUAUUGUUUCACA -26
Get sequence
Mature sequence

Tca-Mir-279-o25_3p

MirBase accessionMIMAT0018817
Sequence
39- UGACUAGAUCGAACACUCGCUU -61
Get sequence