MirGeneDB

MirGeneDB ID

Tca-Mir-279-o23

Family name MIR-279 (all species)
Seed GACUAGA
Species Red flour beetle (Tribolium castaneum)
MiRBase ID tca-mir-279c
Paralogues Tca-Mir-279-o21  Tca-Mir-279-o22  Tca-Mir-279-o24  Tca-Mir-279-o25 
Orthologues Cgi-Mir-279  Isc-Mir-279  Lgi-Mir-279 
Node of Origin (locus) T. castaneum
Node of Origin (family) Protostomia
Genome context
(Tcas5.2)
LG3: 15690069-15690126 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-279-o23)
Mir-3841 LG3: 15689576-15689634 [+] Ensembl
Mir-3840 LG3: 15689698-15689754 [+] Ensembl
Mir-2-P10a LG3: 15689938-15689994 [+] Ensembl
Mir-279-o23 LG3: 15690069-15690126 [+] Ensembl
Mir-3843 LG3: 15690171-15690228 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GAAUUUCGCCGCUUAAAUUCAUAUUUUUUUCGGGUGUUCGUUUCGAGUCACAUUGUGAUUGAUUUUGUGACUAGAUCGAACAUUCGCUCGAAGUAUGGAAAAAUCCGCGGGACUUGUG
Get precursor sequence
Structure
        10          20        30        40        50         
GAAUUUCGCCGCUUAAA--|         UUU          UU  G       UUGUGA 
                   UUCAUAUUUU   CGGGUGUUCG  UC AGUCACA      \
                   AGGUAUGAAG   GCUUACAAGC  AG UCAGUGU      U
GUGUUCAGGGCGCCUAAAA^         CUC          U-  A       UUUAGU 
      110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Ea Em Em Em Em Em Fe Fe Fe Fe Oo
Star sequence

Tca-Mir-279-o23_5p*

MirBase accessionMIMAT0018730
Sequence
0- CGGGUGUUCGUUUCGAGUCACA -22
Get sequence
Mature sequence

Tca-Mir-279-o23_3p

MirBase accessionMIMAT0018731
Sequence
37- UGACUAGAUCGAACAUUCGCU -58
Get sequence