MirGeneDB

MirGeneDB ID

Tca-Mir-2-o52-v2

Family name MIR-2 (all species)
Seed CACAGCC
Species Red flour beetle (Tribolium castaneum)
MiRBase ID tca-mir-2-2
Paralogues Tca-Mir-2-o51-v1  Tca-Mir-2-o51-v2  Tca-Mir-2-o52-v1  Tca-Mir-2-o53-v1  Tca-Mir-2-o53-v2  Tca-Mir-2-P4c  Tca-Mir-2-P4d  Tca-Mir-2-P7  Tca-Mir-2-P8  Tca-Mir-2-P10a  Tca-Mir-2-P10b  Tca-Mir-2-P10c 
Orthologues
Node of Origin (locus) T. castaneum
Node of Origin (family) Protostomia
Genome context
(Tcas5.2)
LG3: 561348-561412 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-2-o52-v2)
Mir-3842 LG3: 559294-559352 [+] Ensembl
Mir-71 LG3: 560714-560776 [+] Ensembl
Mir-2-o53-v1 LG3: 560832-560890 [+] Ensembl
Mir-2-o53-v2 LG3: 560833-560889 [+] Ensembl
Mir-2-P4c LG3: 560954-561011 [+] Ensembl
Mir-2-P4d LG3: 561066-561124 [+] Ensembl
Mir-2-o51-v2 LG3: 561198-561260 [+] Ensembl
Mir-2-o51-v1 LG3: 561200-561258 [+] Ensembl
Mir-2-o52-v2 LG3: 561348-561412 [+] Ensembl
Mir-2-o52-v1 LG3: 561350-561410 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
UUUUUGUACGAUUUUUCAUGGUGUAGGCUUUCGCUCAUCAUCUGGUUGUGAAAUGUGAAUUUAUAUCAUAUCACAGCCAGCUUUGAUGAGCGCAAGAGUGCACUGAUGACGUCAGGUACGAAACU
Get precursor sequence
Structure
        10          20        30        40          50        60 
UUUUUGUACGAUUUUUCAU--      GG   U         U--|         AAUGUGAAU 
                     GGUGUA  CUU CGCUCAUCA   CUGGUUGUGA         \
                     UCACGU  GAA GCGAGUAGU   GACCGACACU         U
UCAAAGCAUGGACUGCAGUAG      GA   C         UUC^         AUACUAUAU 
   120       110       100        90        80        70
Deep sequencing
Go to detailed chart
CommentIt is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and thus these multiple paralogues in invertebrates other than Drosophila are classified here as orphans pending further data and analysis.
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
Ad Ea Em Em Em Em Em Fe Fe Fe Fe Oo
Star sequence

Tca-Mir-2-o52-v2_5p*

MirBase accessionMIMAT0019096
Sequence
0- UCGCUCAUCAUCUGGUUGUGAAA -23
Get sequence
Mature sequence

Tca-Mir-2-o52-v2_3p

MirBase accessionMIMAT0008353
Sequence
40- UCACAGCCAGCUUUGAUGAGCGCAA -65
Get sequence