MirGeneDB

MirGeneDB ID

Tca-Mir-2-P4d

Family name MIR-2 (all species)
Seed AUCACAG
Species Red flour beetle (Tribolium castaneum)
MiRBase ID tca-mir-13b
Paralogues Tca-Mir-2-o51-v1  Tca-Mir-2-o51-v2  Tca-Mir-2-o52-v1  Tca-Mir-2-o52-v2  Tca-Mir-2-o53-v1  Tca-Mir-2-o53-v2  Tca-Mir-2-P4c  Tca-Mir-2-P7  Tca-Mir-2-P8  Tca-Mir-2-P10a  Tca-Mir-2-P10b  Tca-Mir-2-P10c 
Orthologues Aae-Mir-2-P4  Dpu-Mir-2-o4 
Node of Origin (locus) T. castaneum
Node of Origin (family) Protostomia
Genome context
(Tcas5.2)
LG3: 561066-561124 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-2-P4d)
Mir-3842 LG3: 559294-559352 [+] Ensembl
Mir-71 LG3: 560714-560776 [+] Ensembl
Mir-2-o53-v1 LG3: 560832-560890 [+] Ensembl
Mir-2-o53-v2 LG3: 560833-560889 [+] Ensembl
Mir-2-P4c LG3: 560954-561011 [+] Ensembl
Mir-2-P4d LG3: 561066-561124 [+] Ensembl
Mir-2-o51-v2 LG3: 561198-561260 [+] Ensembl
Mir-2-o51-v1 LG3: 561200-561258 [+] Ensembl
Mir-2-o52-v2 LG3: 561348-561412 [+] Ensembl
Mir-2-o52-v1 LG3: 561350-561410 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
CGACGUGGAUUUAAUUGGUCGGUGCCCUAUCAGUCAAUUUGGUUGUGAAACCUAGUAUUUAUUCGGGUAUCACAGCCAUUUUGACGAGUUUGGUUGACGACCUAUUCAUCGAAGAAUCA
Get precursor sequence
Structure
        10         20         30        40        50         
CGACGUGGAUUUAAUUG-    GU-|  CU  CA     UU         A   UAGUAU 
                  GUCG   GCC  AU  GUCAA  UGGUUGUGA ACC      \
                  CAGC   UGG  UG  CAGUU  ACCGACACU UGG      U
ACUAAGAAGCUACUUAUC    AGU^  UU  AG     UU         A   GCUUAU 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Ea Em Em Em Em Em Fe Fe Fe Fe Oo
Star sequence

Tca-Mir-2-P4d_5p*

MirBase accessionMIMAT0019104
Sequence
0- CAGUCAAUUUGGUUGUGAAACC -22
Get sequence
Mature sequence

Tca-Mir-2-P4d_3p

MirBase accessionMIMAT0008360
Sequence
37- UAUCACAGCCAUUUUGACGAGU -59
Get sequence