MirGeneDB

MirGeneDB ID

Sto-Mir-7-P3

Family name MIR-7 (all species)
Seed GGAAGAC
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-7-P1  Sto-Mir-7-P2 
Orthologues Aae-Mir-7  Aca-Mir-7-P3  Ami-Mir-7-P3  Asu-Mir-7  Bfl-Mir-7  Bge-Mir-7  Bta-Mir-7-P3  Cfa-Mir-7-P3  Cgi-Mir-7  Cin-Mir-7  Cli-Mir-7-P3  Cpi-Mir-7-P3  Cpo-Mir-7-P3  Cte-Mir-7  Dan-Mir-7  Dme-Mir-7  Dmo-Mir-7  Dno-Mir-7-P3  Ete-Mir-7-P3  Gga-Mir-7-P3  Hme-Mir-7  Hsa-Mir-7-P3  Isc-Mir-7  Lan-Mir-7  Lgi-Mir-7  Mdo-Mir-7-P3  Mml-Mir-7-P3  Mmu-Mir-7-P3  Ocu-Mir-7-P3  Pfl-Mir-7  Pmi-Mir-7  Rno-Mir-7-P3  Sha-Mir-7-P3  Sko-Mir-7  Spu-Mir-7  Tgu-Mir-7-P3 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(miRNA_loci_genome)
BFAA01252006.1: 658-722 [+]
Precursor
(pre-Mir +30nt flank)
UCGGAUCGAGAUCAGUGGCCUGCUUCUGUUUGGAAGACUAGUGAUUUUGUUGUUUUCUUGUCUGUUGAUUUGACAACAAGUCACAGUCUGCCAUACAGCACCAGGCAGAACACCGUGACGACAAA
Get precursor sequence
Structure
        10          20        30        40        50        60   
UCGGAUCGAGAUCAGUG--|    CUU    U   A     A       U      UUCUUGUC 
                   GCCUG   CUGU UGG AGACU GUGAUUU GUUGUU        \
                   CGGAC   GACA ACC UCUGA CACUGAA CAACAG        U
AAACAGCAGUGCCACAAGA^    CAC    U   G     -       -      UUUAGUUG 
   120       110       100        90         80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Sto-Mir-7-P3_5p

MirBase accessionNone
Sequence
0- UGGAAGACUAGUGAUUUUGUUGUU -24
Get sequence
Star sequence

Sto-Mir-7-P3_3p*

MirBase accessionNone
Sequence
43- CAACAAGUCACAGUCUGCCAUA -65
Get sequence