MirGeneDB

MirGeneDB ID

Sto-Mir-430-o30

Family name MIR-430 (all species)
Seed AAGUGCU
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-430-o28  Sto-Mir-430-o29 
Orthologues Hsa-Mir-430-P30 
Node of Origin (locus) Tetrapoda
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01002990.1: 218430-218489 [-]
Precursor
(pre-Mir +30nt flank)
CAAUUAUCAGUUGUGAAAUGUGUCCCCUGUUACGUCAACAUUGAAGCCUUUCUGUGAUAUACUUCAGUAAGUGCUUUUAUGUUGAAGUGGUCGUGGAUACUUCAUUCUCUGCCAGUGAUA
Get precursor sequence
Structure
        10         20         30        40         50         
CAAUUAUCAGUUGUGAAAU-      CC  -    G       U     -|  UCUGUGAU 
                    GUGUCC  UG UUAC UCAACAU GAAGC CUU        A
                    CAUAGG  GC GGUG AGUUGUA UUUCG GAA        U
AUAGUGACCGUCUCUUACUU      U-  U    A       U     U^  UGACUUCA 
.       110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
To
Star sequence

Sto-Mir-430-o30_5p*

MirBase accessionNone
Sequence
0- UACGUCAACAUUGAAGCCUUUC -22
Get sequence
Mature sequence

Sto-Mir-430-o30_3p

MirBase accessionNone
Sequence
37- UAAGUGCUUUUAUGUUGAAGUGG -60
Get sequence