MirGeneDB

MirGeneDB ID

Sto-Mir-430-o29

Family name MIR-430 (all species)
Seed AAGUACU
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-430-o28  Sto-Mir-430-o30 
Orthologues Hsa-Mir-430-P29  Mml-Mir-430-P29 
Node of Origin (locus) Tetrapoda
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01002990.1: 217783-217842 [-]
Precursor
(pre-Mir +30nt flank)
UGACAUGUUUUAUUAUAACUGUUGCUAGUUACUCCAACAAGUGAAGCUUGCUGUCAAGUUUCAUUAGUAAGUACUCACAUGUUGGAAUCUCUAGCUAACAGGUUUAACCUAUUGAGAAAC
Get precursor sequence
Structure
        10         20         30        40         50         
UGACAUGUUUUAUUAUAA-     -     UUAC       A    A-|      GUCAAG 
                   CUGUU GCUAG    UCCAACA GUGA  GCUUGCU      \
                   GACAA CGAUC    AGGUUGU CACU  UGAAUGA      U
CAAAGAGUUAUCCAAUUUG     U     UCUA       A    CA^      UUACUU 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
To
Star sequence

Sto-Mir-430-o29_5p*

MirBase accessionNone
Sequence
0- ACUCCAACAAGUGAAGCUUGCU -22
Get sequence
Mature sequence

Sto-Mir-430-o29_3p

MirBase accessionNone
Sequence
37- UAAGUACUCACAUGUUGGAAUCU -60
Get sequence