MirGeneDB

MirGeneDB ID

Sto-Mir-430-o28

Family name MIR-430 (all species)
Seed CUCUAAC
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-430-o29  Sto-Mir-430-o30 
Orthologues Hsa-Mir-430-P28  Mml-Mir-430-P28 
Node of Origin (locus) Tetrapoda
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01002990.1: 216825-216879 [-]
Precursor
(pre-Mir +30nt flank)
AGUCUUUUCCAAUGGAAUUGUGAAGUGGAGCCUCUAACAUGUGAGAACUUGCUCUCAUUGAAGUAAGUGCUCGCUUGUUGGGAUUUCUACUGCUCAACAGUACAACUUUUGAGAA
Get precursor sequence
Structure
        10         20        30        40        50       
AGUCUUUUCCAAUGGAA-|  UGA       CC       U     A      UCUC 
                  UUG   AGUGGAG  UCUAACA GUGAG ACUUGC    A
                  AAC   UCAUCUU  GGGUUGU CGCUC UGAAUG    U
AAGAGUUUUCAACAUGAC^  UCG       UA       U     G      AAGU 
   110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Sto-Mir-430-o28_5p

MirBase accessionNone
Sequence
0- CCUCUAACAUGUGAGAACUUGC -22
Get sequence
Co-mature sequence

Sto-Mir-430-o28_3p

MirBase accessionNone
Sequence
33- UAAGUGCUCGCUUGUUGGGAUU -55
Get sequence