MirGeneDB

MirGeneDB ID

Sto-Mir-30-P2c

Family name MIR-30 (all species)
Seed GUAAACA
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-30-P1b  Sto-Mir-30-P1c  Sto-Mir-30-P1d  Sto-Mir-30-P2a  Sto-Mir-30-P2b 
Orthologues Aca-Mir-30-P2c  Ami-Mir-30-P2c  Bta-Mir-30-P2c  Cfa-Mir-30-P2c  Cpi-Mir-30-P2c  Cpo-Mir-30-P2c  Dno-Mir-30-P2c  Dre-Mir-30-P2c  Ete-Mir-30-P2c  Gga-Mir-30-P2c  Hsa-Mir-30-P2c  Mdo-Mir-30-P2c  Mml-Mir-30-P2c  Mmu-Mir-30-P2c  Oan-Mir-30-P2c  Ocu-Mir-30-P2c  Rno-Mir-30-P2c  Sha-Mir-30-P2c  Tgu-Mir-30-P2c  Xtr-Mir-30-P2c 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01001400.1: 433282-433340 [+]
Precursor
(pre-Mir +30nt flank)
CUUGACCGUGUGCAACUGAGCUCCAGGCACUGUAAACAUCCUACACUCAGCUGUAACAUAAAAGAGGCUGAGAGAAGGUUGUUUACUUUAACUGGCUUGGAACAGCAACUUUUUAAAAU
Get precursor sequence
Structure
        10        20        30             40        50         
CUUGACCGUGUGCAACUGAGC       ACU-----|      U   ACA       GUAACA 
                     UCCAGGC        GUAAACA CCU   CUCAGCU      \
                     AGGUUCG        CAUUUGU GGA   GAGUCGG      U
UAAAAUUUUUCAACGACA---       GUCAAUUU^      U   AGA       AGAAAA 
       110          100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Sto-Mir-30-P2c_5p

MirBase accessionNone
Sequence
0- UGUAAACAUCCUACACUCAGCU -22
Get sequence
Star sequence

Sto-Mir-30-P2c_3p*

MirBase accessionNone
Sequence
37- CUGAGAGAAGGUUGUUUACUUU -59
Get sequence