MirGeneDB

MirGeneDB ID

Sto-Mir-30-P1d

Family name MIR-30 (all species)
Seed GUAAACA
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-30-P1b  Sto-Mir-30-P1c  Sto-Mir-30-P2a  Sto-Mir-30-P2b  Sto-Mir-30-P2c 
Orthologues
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01005240.1: 134438-134501 [-]
Precursor
(pre-Mir +30nt flank)
UUAUUCAGUUAUGCUCUGGUGCAGCGGUCAUGUAAACAUCUUUAACUGAAAGCUUUACGUACUAAAUAACGGCUUUCAGUUGGAUGUUUAUGUUACCUUGUCACUAAAAAUCUCUGAAUUUCCU
Get precursor sequence
Structure
        10          20         30        40        50        60  
UUAUUCAGUUAUGCUCU--    -|  C   C            UU           UUACGUA 
                   GGUG CAG GGU AUGUAAACAUCU  AACUGAAAGCU       C
                   UCAC GUU CCA UGUAUUUGUAGG  UUGACUUUCGG       U
UCCUUUAAGUCUCUAAAAA    U^  -   U            --           CAAUAAA 
  120       110       100         90          80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
To
Mature sequence

Sto-Mir-30-P1d_5p

MirBase accessionNone
Sequence
0- UGUAAACAUCUUUAACUGAAAGCU -24
Get sequence
Star sequence

Sto-Mir-30-P1d_3p*

MirBase accessionNone
Sequence
42- CUUUCAGUUGGAUGUUUAUGUU -64
Get sequence