MirGeneDB

MirGeneDB ID

Sto-Mir-29-P2a

Family name MIR-29 (all species)
Seed AGCACCA
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-29-P1a  Sto-Mir-29-P1b  Sto-Mir-29-P2b 
Orthologues Aae-Mir-29-P2  Aca-Mir-29-P2a  Ami-Mir-29-P2a-v1  Ami-Mir-29-P2a-v2  Asu-Mir-29-P2  Bfl-Mir-29-P2  Bta-Mir-29-P2a  Cbr-Mir-29-P2  Cel-Mir-29-P2  Cfa-Mir-29-P2a  Cgi-Mir-29-P2  Cli-Mir-29-P2a  Cpi-Mir-29-P2a  Cpo-Mir-29-P2a  Cte-Mir-29-P2  Dan-Mir-29-P2  Dme-Mir-29-P2  Dmo-Mir-29-P2  Dno-Mir-29-P2a  Dre-Mir-29-P2a  Ete-Mir-29-P2a  Gga-Mir-29-P2a  Hme-Mir-29-P2  Hsa-Mir-29-P2a  Mdo-Mir-29-P2a  Mml-Mir-29-P2a  Mmu-Mir-29-P2a  Oan-Mir-29-P2a  Ocu-Mir-29-P2a  Pfl-Mir-29-P2  Pmi-Mir-29-P2  Rno-Mir-29-P2a  Sha-Mir-29-P2a  Sko-Mir-29-P2  Spu-Mir-29-P2  Tca-Mir-29-P2  Tgu-Mir-29-P2a  Xtr-Mir-29-P2a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(miRNA_loci_genome)
BFAA01004289.1: 36703-36764 [-]
Precursor
(pre-Mir +30nt flank)
UGAAGAAGGCGGUGUAACUUCUCCAGGAGCCUGGUUCCAUAUGGUGGUUUAGAUUUAACUGAGCUGUGUCUAGCACCAUUUGAAAUCAGUGUUCUUGGAGAAAGGCUCGCAUCACAACUCUC
Get precursor sequence
Structure
        10          20        30         40        50        60 
UGAAGAAGGCGGUGUAAC--            -|     C  U      GU     UUUAACU 
                    UUCUCCAGGAGC CUGGUU CA AUGGUG  UUAGA       \
                    AAGAGGUUCUUG GACUAA GU UACCAC  GAUCU       G
CUCUCAACACUACGCUCGGA            U^     A  U      --     GUGUCGA 
120       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Sto-Mir-29-P2a_5p*

MirBase accessionNone
Sequence
0- CUGGUUCCAUAUGGUGGUUUAGA -23
Get sequence
Mature sequence

Sto-Mir-29-P2a_3p

MirBase accessionNone
Sequence
40- UAGCACCAUUUGAAAUCAGUGU -62
Get sequence