MirGeneDB

MirGeneDB ID

Sto-Mir-29-P1a

Family name MIR-29 (all species)
Seed AGCACCA
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-29-P1b  Sto-Mir-29-P2a  Sto-Mir-29-P2b 
Orthologues Aca-Mir-29-P1a  Ami-Mir-29-P1a  Asu-Mir-29-P1  Bfl-Mir-29-P1  Bta-Mir-29-P1a  Cbr-Mir-29-P1  Cel-Mir-29-P1  Cfa-Mir-29-P1a  Cgi-Mir-29-P1  Cin-Mir-29-P1  Cli-Mir-29-P1a  Cpi-Mir-29-P1a  Cpo-Mir-29-P1a  Cte-Mir-29-P1  Dno-Mir-29-P1a  Dre-Mir-29-P1a  Ete-Mir-29-P1a  Gga-Mir-29-P1a  Hsa-Mir-29-P1a  Isc-Mir-29-P1  Lgi-Mir-29-P1  Mdo-Mir-29-P1a  Mml-Mir-29-P1a  Mmu-Mir-29-P1a  Oan-Mir-29-P1a  Ocu-Mir-29-P1a  Pfl-Mir-29-P1  Pmi-Mir-29-P1  Rno-Mir-29-P1a  Sha-Mir-29-P1a  Sko-Mir-29-P1  Spu-Mir-29-P1  Tgu-Mir-29-P1a  Xtr-Mir-29-P1a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(miRNA_loci_genome)
BFAA01004289.1: 34563-34622 [-]
Precursor
(pre-Mir +30nt flank)
CAUGCACCCCCCCCCCCCACUUAGAGGAUGACUGAUUUCUCUUGGUGUUUAGAGUCUAUAUAUUUAUCUAGCACCAUUUGAAAUCGGUUAUAAUGAUUGGGGAACAACAGCUGUCUUCAG
Get precursor sequence
Structure
        10        20          30        40        50          
CAUGCACCCCCCCCCCCCA     AGG--|           UCU       U   GUCUAU 
                   CUUAG     AUGACUGAUUUC   UGGUGUU AGA      \
                   GGGUU     UAUUGGCUAAAG   ACCACGA UCU      A
GACUUCUGUCGACAACAAG     AGUAA^           UUU       -   AUUUAU 
.       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Sto-Mir-29-P1a_5p*

MirBase accessionNone
Sequence
0- ACUGAUUUCUCUUGGUGUUUAGA -23
Get sequence
Mature sequence

Sto-Mir-29-P1a_3p

MirBase accessionNone
Sequence
38- UAGCACCAUUUGAAAUCGGUUA -60
Get sequence