MirGeneDB

MirGeneDB ID

Sto-Mir-27-o1

Family name MIR-27 (all species)
Seed AGAACUU
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-27-P1  Sto-Mir-27-P2 
Orthologues Aca-Mir-27-P1  Ami-Mir-27-P1  Bta-Mir-27-P1  Cfa-Mir-27-P1  Cpi-Mir-27-P1  Cpo-Mir-27-P1  Dno-Mir-27-P1  Dre-Mir-27-P1  Ete-Mir-27-P1  Hsa-Mir-27-P1  Mdo-Mir-27-P1  Mml-Mir-27-P1  Mmu-Mir-27-P1  Oan-Mir-27-P1  Rno-Mir-27-P1  Sha-Mir-27-P1  Tgu-Mir-27-P1  Xtr-Mir-27-P1 
Node of Origin (locus) S. torazame
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01000014.1: 1438467-1438532 [+]
Precursor
(pre-Mir +30nt flank)
UCGCCAGAGAAAUUCCUCUUUAGACUGGCCUAGAACUUAGCUAUUUGGAGAGCAGUGGCCUUCAAUGAAAUCCUGUUCACAGUGGCUAAGUUCAGUUCCUCUGAAGAAUUUUACAAUUGCAUCAAU
Get precursor sequence
Structure
        10           20        30        40         50        60  
UCGCCAGAGAAAUUCCU---|      CU GC  A             -    G  CAGUGGCCU 
                    CUUUAGA  G  CU GAACUUAGCUAUU UGGA AG         U
                    GAAGUCU  C  GA CUUGAAUCGGUGA ACUU UC         C
UAACUACGUUAACAUUUUAA^      C- UU  -             C    G  CUAAAGUAA 
    120       110       100          90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
To
Mature sequence

Sto-Mir-27-o1_5p

MirBase accessionNone
Sequence
0- UAGAACUUAGCUAUUUGGAGAGC -23
Get sequence
Co-mature sequence

Sto-Mir-27-o1_3p

MirBase accessionNone
Sequence
45- UUCACAGUGGCUAAGUUCAGU -66
Get sequence