MirGeneDB

MirGeneDB ID

Sto-Mir-27-P1

Family name MIR-27 (all species)
Seed GGACUUA
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-27-o1  Sto-Mir-27-P2 
Orthologues Aca-Mir-27-P1  Ami-Mir-27-P1  Bta-Mir-27-P1  Cfa-Mir-27-P1  Cpi-Mir-27-P1  Cpo-Mir-27-P1  Dno-Mir-27-P1  Dre-Mir-27-P1  Ete-Mir-27-P1  Hsa-Mir-27-P1  Mdo-Mir-27-P1  Mml-Mir-27-P1  Mmu-Mir-27-P1  Oan-Mir-27-P1  Rno-Mir-27-P1  Sha-Mir-27-P1  Tgu-Mir-27-P1  Xtr-Mir-27-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01001728.1: 154600-154664 [-]
Precursor
(pre-Mir +30nt flank)
GGGAUUUUGUCUCUGAGCCCUGUGCGGUGAAGGACUUAGCUAACUCUGUGAACAGAUCUUUGAAUGCCUUCAUGUUCACAGUGGCUAAGUUCCGCACCUCAGGGGGUCAAACGCAAGAGGAUUUC
Get precursor sequence
Structure
        10          20        30        40        50        60   
GGGAUUUUGUCUCUGAG--|   G  C    AA           ACU         GAUCUUUG 
                   CCCU UG GGUG  GGACUUAGCUA   CUGUGAACA        A
                   GGGG AC CCAC  CUUGAAUCGGU   GACACUUGU        A
CUUUAGGAGAACGCAAACU^   G  U    GC           ---         ACUUCCGU 
   120       110       100        90           80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
To
Mature sequence

Sto-Mir-27-P1_5p

MirBase accessionNone
Sequence
0- AGGACUUAGCUAACUCUGUGAACA -24
Get sequence
Co-mature sequence

Sto-Mir-27-P1_3p

MirBase accessionNone
Sequence
44- UUCACAGUGGCUAAGUUCCGC -65
Get sequence