MirGeneDB

MirGeneDB ID

Sto-Mir-24-o1

Family name MIR-24 (all species)
Seed GGCUCAG
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-24-o2  Sto-Mir-24-P1  Sto-Mir-24-P2 
Orthologues Aca-Mir-24-P1  Ami-Mir-24-P1  Bta-Mir-24-P1  Cfa-Mir-24-P1  Cpi-Mir-24-P1  Cpo-Mir-24-P1  Dno-Mir-24-P1  Dre-Mir-24-P1  Ete-Mir-24-P1  Hsa-Mir-24-P1  Mdo-Mir-24-P1  Mml-Mir-24-P1  Mmu-Mir-24-P1  Oan-Mir-24-P1  Ocu-Mir-24-P1  Rno-Mir-24-P1  Sha-Mir-24-P1  Xtr-Mir-24-P1 
Node of Origin (locus) S. torazame
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01000014.1: 1439309-1439368 [+]
Precursor
(pre-Mir +30nt flank)
GAGAUGUCAGAAAACAGGCCCUGAUCUCCUGUGCCUACUGAACUGAUAUCAGUGAGUUAUGAAAGUGCUGGCUCAGUUCAGCAGGAACUGGAGUCUGGCCUAACGAUAUCCUGUGGAGGA
Get precursor sequence
Structure
        10            20        30        40        50          
GAGAUGUCAGAAAACAG----|  CU  U    U  G   A         UA     GAGUUA 
                     GCC  GA CUCC GU CCU CUGAACUGA  UCAGU      \
                     CGG  CU GAGG CA GGA GACUUGACU  GGUCG      U
AGGAGGUGUCCUAUAGCAAUC^  U-  -    U  A   C         C-     UGAAAG 
.       110       100          90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
To
Star sequence

Sto-Mir-24-o1_5p*

MirBase accessionNone
Sequence
0- GUGCCUACUGAACUGAUAUCAGU -23
Get sequence
Mature sequence

Sto-Mir-24-o1_3p

MirBase accessionNone
Sequence
38- UGGCUCAGUUCAGCAGGAACUG -60
Get sequence