MirGeneDB

MirGeneDB ID

Sto-Mir-23-o2

Family name MIR-23 (all species)
Seed UCACAUU
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-23-o1  Sto-Mir-23-P1  Sto-Mir-23-P2 
Orthologues Aca-Mir-23-P2  Ami-Mir-23-P2  Bta-Mir-23-P2  Cfa-Mir-23-P2  Cli-Mir-23-P2  Cpi-Mir-23-P2  Cpo-Mir-23-P2  Dno-Mir-23-P2  Dre-Mir-23-P2a  Dre-Mir-23-P2b  Ete-Mir-23-P2  Gga-Mir-23-P2  Hsa-Mir-23-P2  Mdo-Mir-23-P2  Mml-Mir-23-P2  Mmu-Mir-23-P2  Oan-Mir-23-P2  Ocu-Mir-23-P2  Rno-Mir-23-P2  Sha-Mir-23-P2  Tgu-Mir-23-P2  Xtr-Mir-23-P2 
Node of Origin (locus) S. torazame
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01002570.1: 222580-222638 [-]
Precursor
(pre-Mir +30nt flank)
UCGUUGCCUAGGUUUCCACUGUUGCUGAAGGGGAUUCCUGGUGAUGUGAUUUUCGACGAAUCGCAGAAUCACAUUGCCAGGGAUUACCAGUUGGUGACAUGUGUACCGCACCGGAACAA
Get precursor sequence
Structure
        10         20        30         40        50         
UCGUUGCCUAGGUUUCCAC-   UG UG AG  -|        UG         UCGACG 
                    UGU  C  A  GG GAUUCCUGG  AUGUGAUUU      \
                    ACA  G  U  CC UUAGGGACC  UACACUAAG      A
AACAAGGCCACGCCAUGUGU   GU GU GA  A^        GU         ACGCUA 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Sto-Mir-23-o2_5p*

MirBase accessionNone
Sequence
0- GGGAUUCCUGGUGAUGUGAUUU -22
Get sequence
Mature sequence

Sto-Mir-23-o2_3p

MirBase accessionNone
Sequence
37- AUCACAUUGCCAGGGAUUACCA -59
Get sequence