MirGeneDB

MirGeneDB ID

Sto-Mir-23-o1

Family name MIR-23 (all species)
Seed UCACAUU
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-23-o2  Sto-Mir-23-P1  Sto-Mir-23-P2 
Orthologues Aca-Mir-23-P1  Ami-Mir-23-P1  Bta-Mir-23-P1  Cfa-Mir-23-P1  Cpi-Mir-23-P1  Cpo-Mir-23-P1  Dno-Mir-23-P1  Dre-Mir-23-P1  Ete-Mir-23-P1  Hsa-Mir-23-P1  Mdo-Mir-23-P1  Mml-Mir-23-P1  Mmu-Mir-23-P1  Oan-Mir-23-P1  Rno-Mir-23-P1  Sha-Mir-23-P1  Xtr-Mir-23-P1 
Node of Origin (locus) S. torazame
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01000014.1: 1434855-1434919 [+]
Precursor
(pre-Mir +30nt flank)
CAGCCCACUCCUCUCUUGCUGUGACUGUAGGGGUUCCUGGCAUUGUGAUUUAAUGAUUAAAUAAAAGUGAAAAAUCACAUUGCCAGGGAUUACCACAGAGUCACAGGCACAGGCAGCUGCUCGCG
Get precursor sequence
Structure
        10         20          30         40        50        60 
CAGCCCACUCCUCUCUUG-       --|  A  -           U        AAUGAUUAA 
                   CUGUGAC  UGU GG GGUUCCUGGCA UGUGAUUU         A
                   GACACUG  ACA CC UUAGGGACCGU ACACUAAA         U
GCGCUCGUCGACGGACACG       AG^  -  A           U        AAGUGAAAA 
   120       110       100         90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
To
Star sequence

Sto-Mir-23-o1_5p*

MirBase accessionNone
Sequence
0- GGGUUCCUGGCAUUGUGAUUU -21
Get sequence
Mature sequence

Sto-Mir-23-o1_3p

MirBase accessionNone
Sequence
43- AUCACAUUGCCAGGGAUUACCA -65
Get sequence