MirGeneDB

MirGeneDB ID

Sto-Mir-219-P1-v1

Family name MIR-219 (all species)
Seed AGAAUUG
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-219-P1-v2  Sto-Mir-219-P2 
Orthologues Aae-Mir-219  Aca-Mir-219-P1  Ami-Mir-219-P1  Bfl-Mir-219  Bge-Mir-219  Bta-Mir-219-P1  Cfa-Mir-219-P1  Cgi-Mir-219  Cin-Mir-219  Cpi-Mir-219-P1  Cpo-Mir-219-P1  Cte-Mir-219  Dan-Mir-219  Dme-Mir-219  Dmo-Mir-219  Dno-Mir-219-P1  Dpu-Mir-219  Dre-Mir-219-P1a  Ete-Mir-219-P1  Hsa-Mir-219-P1  Isc-Mir-219  Lan-Mir-219  Mdo-Mir-219-P1  Mml-Mir-219-P1  Mmu-Mir-219-P1  Mmu-Mir-219-P1-as  Ocu-Mir-219-P1  Pfl-Mir-219  Pmi-Mir-219  Rno-Mir-219-P1  Sha-Mir-219-P1  Sko-Mir-219  Spu-Mir-219  Tca-Mir-219 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(miRNA_loci_genome)
BFAA01017937.1: 11339-11405 [+]
Precursor
(pre-Mir +30nt flank)
GGGGUGAAAAACCUUAGAAAUUCUCGCUAUUGAUUGUCCAAACGCAAUUCUUGUGUUUUUCCAAAUCGGACCCCGAGAAUUGUAGAUGGACAUCCUUAGCUGGAUUUUCACAUUCUUCUUUCGCGGU
Get precursor sequence
Structure
        10           20        30        40        50        60   
GGGGUGAAAAACCUUAG---|     UC    UU   U     AAC          UGUUUUUCC 
                    AAAUUC  GCUA  GAU GUCCA   GCAAUUCUUG         A
                    UUUAGG  CGAU  CUA CAGGU   UGUUAAGAGC         A
UGGCGCUUUCUUCUUACACU^     U-    UC   -     AGA          CCCAGGCUA 
     120       110        100         90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Sto-Mir-219-P1-v1_5p*

MirBase accessionNone
Sequence
0- UGAUUGUCCAAACGCAAUUCUUGU -24
Get sequence
Mature sequence

Sto-Mir-219-P1-v1_3p

MirBase accessionNone
Sequence
44- GAGAAUUGUAGAUGGACAUCCUU -67
Get sequence