MirGeneDB

MirGeneDB ID

Sto-Mir-218-P1

Family name MIR-218 (all species)
Seed UGUGCUU
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-218-P2 
Orthologues Aca-Mir-218-P1  Ami-Mir-218-P1  Bta-Mir-218-P1  Cfa-Mir-218-P1  Cli-Mir-218-P1  Cpi-Mir-218-P1  Cpo-Mir-218-P1  Dno-Mir-218-P1  Dre-Mir-218-P1  Ete-Mir-218-P1  Gga-Mir-218-P1  Hsa-Mir-218-P1  Mdo-Mir-218-P1  Mml-Mir-218-P1  Mmu-Mir-218-P1  Oan-Mir-218-P1  Ocu-Mir-218-P1  Rno-Mir-218-P1  Sha-Mir-218-P1  Tgu-Mir-218-P1  Xtr-Mir-218-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01002126.1: 399127-399190 [+]
Precursor
(pre-Mir +30nt flank)
UGCGGUUCUGAAACUGAGCGGGAUUUUCCGUUGUGCUUGAUCUAACCAUGUGGUUGCAAGGUACGAAUAAAACAUGGUUCUGUCAAGCACCAUGGAGCGUCACGUAUGCCUUCUACAGCAUGCC
Get precursor sequence
Structure
        10          20        30        40        50        60 
UGCGGUUCUGAAACUGA--|  G   U      U         CU        GGUUGCAAG 
                   GCG GAU UUCCGU GUGCUUGAU  AACCAUGU         G
                   UGC CUG GAGGUA CACGAACUG  UUGGUACA         U
CCGUACGACAUCUUCCGUA^  A   C      C         UC        AAAUAAGCA 
  120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Sto-Mir-218-P1_5p

MirBase accessionNone
Sequence
0- UUGUGCUUGAUCUAACCAUGUG -22
Get sequence
Star sequence

Sto-Mir-218-P1_3p* (predicted)

MirBase accessionNone
Sequence
42- CAUGGUUCUGUCAAGCACCAUG -64
Get sequence