MirGeneDB

MirGeneDB ID

Sto-Mir-216-P1b

Family name MIR-216 (all species)
Seed AAUCUCU
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-216-P1a 
Orthologues Aae-Mir-216-P1  Aca-Mir-216-P1b  Ami-Mir-216-P1b  Asu-Mir-216-P1  Bfl-Mir-216-P1  Bge-Mir-216-P1  Bta-Mir-216-P1b  Cbr-Mir-216-P1  Cel-Mir-216-P1  Cfa-Mir-216-P1b  Cgi-Mir-216-P1  Cli-Mir-216-P1b  Cpi-Mir-216-P1b  Cpo-Mir-216-P1b  Dan-Mir-216-P1  Dme-Mir-216-P1  Dmo-Mir-216-P1  Dno-Mir-216-P1b  Dpu-Mir-216-P1  Dre-Mir-216-P1b  Efe-Mir-216-P1  Ete-Mir-216-P1b  Gga-Mir-216-P1b  Hme-Mir-216-P1  Hsa-Mir-216-P1b  Isc-Mir-216-P1  Lgi-Mir-216-P1  Mdo-Mir-216-P1b  Mml-Mir-216-P1b  Mmu-Mir-216-P1b  Oan-Mir-216-P1b  Ocu-Mir-216-P1b  Rno-Mir-216-P1b  Sha-Mir-216-P1b  Tca-Mir-216-P1  Tgu-Mir-216-P1b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(miRNA_loci_genome)
BFAA01001329.1: 91747-91807 [+]
Precursor
(pre-Mir +30nt flank)
ACUUGUUGUGAUAUCUAGCUGCAGACUAGAUAAUCUCUGCAGGCAACUGUGAAGUAUUUUCACAAUCUCACAAUAGCCUACAGAGAUUCUGUAGUCUGUUGCCUCUACUAACAACUUCUCA
Get precursor sequence
Structure
        10          20        30        40        50          
ACUUGUUGUGAUAUCUA--| U        GAU        C    AAC     AGUAUUU 
                   GC GCAGACUA   AAUCUCUG AGGC   UGUGA       \
                   CG UGUCUGAU   UUAGAGAC UCCG   ACACU       U
ACUCUUCAACAAUCAUCUC^ U        GUC        A    AUA     CUAACAC 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
To
Mature sequence

Sto-Mir-216-P1b_5p

MirBase accessionNone
Sequence
0- UAAUCUCUGCAGGCAACUGUGA -22
Get sequence
Star sequence

Sto-Mir-216-P1b_3p*

MirBase accessionNone
Sequence
39- ACAAUAGCCUACAGAGAUUCUG -61
Get sequence