MirGeneDB

MirGeneDB ID

Sto-Mir-208-P2

Family name MIR-208 (all species)
Seed UUAAGAC
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues
Orthologues Bta-Mir-208-P2  Cfa-Mir-208-P2  Cpo-Mir-208-P2  Dno-Mir-208-P2  Dre-Mir-208-P2  Ete-Mir-208-P2a  Ete-Mir-208-P2b  Hsa-Mir-208-P2  Mdo-Mir-208-P2  Mml-Mir-208-P2  Mmu-Mir-208-P2  Ocu-Mir-208-P2  Rno-Mir-208-P2  Sha-Mir-208-P2 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01271854.1: 421-480 [+]
Precursor
(pre-Mir +30nt flank)
CGUUACCUGCAGACAUUCCUCCAGACUGUCAGAUCUUUUGUUCUUUUUAAUAUUGAGUUACGAUAUGUUUAAGACGAACAGAAGAUUUUGCAGUUUGGGGGAUUAGCGCCUGGCCUGAAG
Get precursor sequence
Structure
        10          20        30        40        50         
CGUUACCUGCAGACAUU--|           C             U      UAUUGAGU 
                   CCUCCAGACUGU AGAUCUUUUGUUC UUUUAA        U
                   GGGGGUUUGACG UUUAGAAGACAAG AGAAUU        A
GAAGUCCGGUCCGCGAUUA^           U             C      UGUAUAGC 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Sto-Mir-208-P2_5p*

MirBase accessionNone
Sequence
0- AGAUCUUUUGUUCUUUUUAAUA -22
Get sequence
Mature sequence

Sto-Mir-208-P2_3p

MirBase accessionNone
Sequence
37- UUUAAGACGAACAGAAGAUUUUG -60
Get sequence