MirGeneDB

MirGeneDB ID

Sto-Mir-205-P3

Family name MIR-205 (all species)
Seed CCUUCAU
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-205-P1  Sto-Mir-205-P2 
Orthologues Xtr-Mir-205-P3 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01000934.1: 396938-396999 [+]
Precursor
(pre-Mir +30nt flank)
ACAACAAGACAAGGAAGACACAUUCUGAUGUCCUUCAUUCCACCGGAGUCUGUGUCCAUCUCUGAUCCAGAUUCCCAGUGAGAUGAAGCGCAUGAGAUGCGUCCAUGAGCAACGGAAGCAUG
Get precursor sequence
Structure
        10           20        30        40         50          
ACAACAAGACAAGGAAG---| A   U  G    C      UC   C-       GUGUCCAU 
                    AC CAU CU AUGU CUUCAU  CAC  GGAGUCU        \
                    UG GUA GA UACG GAAGUA  GUG  CCUUAGA        C
GUACGAAGGCAACGAGUACC^ C   -  G    C      GA   AC       CCUAGUCU 
120       110       100         90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
To
Mature sequence

Sto-Mir-205-P3_5p

MirBase accessionNone
Sequence
0- UCCUUCAUUCCACCGGAGUCU -21
Get sequence
Star sequence

Sto-Mir-205-P3_3p*

MirBase accessionNone
Sequence
40- AUUCCCAGUGAGAUGAAGCGCA -62
Get sequence