MirGeneDB

MirGeneDB ID

Sto-Mir-190-P2

Family name MIR-190 (all species)
Seed GAUAUGU
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-190-P1 
Orthologues Aae-Mir-190  Aca-Mir-190-P2  Ami-Mir-190-P2  Asu-Mir-190  Bfl-Mir-190  Bge-Mir-190  Bta-Mir-190-P2  Cbr-Mir-190  Cel-Mir-190  Cfa-Mir-190-P2  Cgi-Mir-190  Cpi-Mir-190-P2  Cpo-Mir-190-P2  Cte-Mir-190  Dan-Mir-190  Dme-Mir-190  Dmo-Mir-190  Dno-Mir-190-P2  Dpu-Mir-190  Dre-Mir-190-P2  Ete-Mir-190-P2  Gga-Mir-190-P2  Hme-Mir-190  Hsa-Mir-190-P2  Isc-Mir-190  Mdo-Mir-190-P2  Mml-Mir-190-P2  Mmu-Mir-190-P2  Oan-Mir-190-P2  Ocu-Mir-190-P2  Pfl-Mir-190  Pmi-Mir-190  Rno-Mir-190-P2  Sha-Mir-190-P2  Sko-Mir-190  Tca-Mir-190  Tgu-Mir-190-P2  Xtr-Mir-190-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(miRNA_loci_genome)
BFAA01025282.1: 4654-4714 [+]
Precursor
(pre-Mir +30nt flank)
CAUUGCUUGCUCACUCUGCCUGCCUCUGUUUGAUAUGUUUGAUAUUGGGUUGUUUUUUUGAAAAAGCAACUAUAUAUUAGACAUAUUCCUCCAGCGCCGGGCUCGAUCAACCGGACACACA
Get precursor sequence
Structure
        10          20        30         40        50         
CAUUGCUUGCUCACUCU--     CCU   UUU-|             UG     UUUUUU 
                   GCCUG   CUG    GAUAUGUUUGAUAU  GGUUG      U
                   CGGGC   GAC    UUAUACAGAUUAUA  UCAAC      G
ACACACAGGCCAACUAGCU     CGC   CUCC^             UA     GAAAAA 
 .       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Sto-Mir-190-P2_5p

MirBase accessionNone
Sequence
0- UGAUAUGUUUGAUAUUGGGUUG -22
Get sequence
Star sequence

Sto-Mir-190-P2_3p* (predicted)

MirBase accessionNone
Sequence
38- ACUAUAUAUUAGACAUAUUCCUC -61
Get sequence