MirGeneDB

MirGeneDB ID

Sto-Mir-19-P2d

Family name MIR-19 (all species)
Seed GUGCAAA
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-19-P1  Sto-Mir-19-P2a  Sto-Mir-19-P2b 
Orthologues
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01001891.1: 347717-347779 [+]
Precursor
(pre-Mir +30nt flank)
UUCGGUGCUGGAUGGUGCCGACUCGCGGUUAGUUUUGCUGGCUUUGCAGUCAGUUGGUGAUCCUCAUUGCUGUGCAAAUCCACGCAAAACUGACCGCGUCGGCAAUGGCGACAAUCUCUCACG
Get precursor sequence
Structure
        10            20        30         40        50        60 
UUCGGUGCUGGAUGGUG----|    UC              -   C      GU    UGGUGA 
                     CCGAC  GCGGUUAGUUUUGC UGG UUUGCA  CAGU      U
                     GGCUG  CGCCAGUCAAAACG ACC AAACGU  GUCG      C
GCACUCUCUAACAGCGGUAAC^    --              C   U      --    UUACUC 
 120       110       100          90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Sto-Mir-19-P2d_5p*

MirBase accessionNone
Sequence
0- AGUUUUGCUGGCUUUGCAGUCAGU -24
Get sequence
Mature sequence

Sto-Mir-19-P2d_3p

MirBase accessionNone
Sequence
40- UGUGCAAAUCCACGCAAAACUGA -63
Get sequence