MirGeneDB

MirGeneDB ID

Sto-Mir-17-P3d

Family name MIR-17 (all species)
Seed AAAGUGC
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-17-P1a  Sto-Mir-17-P1d  Sto-Mir-17-P2a  Sto-Mir-17-P2b  Sto-Mir-17-P3a  Sto-Mir-17-P3c 
Orthologues
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01001891.1: 342587-342646 [+]
Precursor
(pre-Mir +30nt flank)
CUAUUGUGCGGCCAUCUGUCCGAGUAGUGCCAAAGUGCUGACAGUGCAGGUAGUGAUGAGGCCUUCUACUGCAGUGUAAGCACUUAACGUACUCCUUGUGUACACCAUCUUCCCUGAAGC
Get precursor sequence
Structure
        10        20          30         40        50         
CUAUUGUGCGGCCAUCUGUC--    U     CA-|      G   G     G   UGAUG 
                      CGAG AGUGC   AAGUGCU ACA UGCAG UAG     A
                      GUUC UCAUG   UUCACGA UGU ACGUC AUC     G
CGAAGUCCCUUCUACCACAUGU    C     CAA^      A   G     -   UUCCG 
.       110       100        90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Sto-Mir-17-P3d_5p

MirBase accessionNone
Sequence
0- CAAAGUGCUGACAGUGCAGGUAG -23
Get sequence
Star sequence

Sto-Mir-17-P3d_3p*

MirBase accessionNone
Sequence
37- ACUGCAGUGUAAGCACUUAACGU -60
Get sequence