MirGeneDB

MirGeneDB ID

Sto-Mir-146-o1

Family name MIR-146 (all species)
Seed GAGAACU
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-146-P3 
Orthologues Ami-Mir-146-P1  Bta-Mir-146-P1-v1  Bta-Mir-146-P1-v2  Cfa-Mir-146-P1  Cli-Mir-146-P1  Cpi-Mir-146-P1  Cpo-Mir-146-P1  Dno-Mir-146-P1  Dre-Mir-146-P1-v1  Dre-Mir-146-P1-v2  Gga-Mir-146-P1  Hsa-Mir-146-P1  Mdo-Mir-146-P1  Mml-Mir-146-P1  Mmu-Mir-146-P1  Oan-Mir-146-P1  Ocu-Mir-146-P1  Rno-Mir-146-P1  Sha-Mir-146-P1  Tgu-Mir-146-P1  Xtr-Mir-146-P1 
Node of Origin (locus) S. torazame
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01000071.1: 1362635-1362698 [+]
Precursor
(pre-Mir +30nt flank)
CUUCAGACUGAUGCAAGUUGCCCCCAGCUGUGAGAACUGAAUUCCAUGAGUUGUUCGAGCUACUGUUUCUCAGCCCAUGGUUCUCAGUUCUGCAGCUUGGAAGCAUUUUAUGUCUAAUGGGUGA
Get precursor sequence
Structure
        10         20         30        40        50        60  
CUUCAGACUGAUGCAAGU-   CC  -|     G        AUU     A    UUCGAGCU 
                   UGC  CC AGCUGU AGAACUGA   CCAUG GUUG        \
                   ACG  GG UCGACG UCUUGACU   GGUAC CGAC        A
AGUGGGUAAUCUGUAUUUU   AA  U^     -        CUU     C    UCUUUGUC 
  120       110       100         90        80        70
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsNo
Tissue expression
 +
To
Mature sequence

Sto-Mir-146-o1_5p

MirBase accessionNone
Sequence
0- UGAGAACUGAAUUCCAUGAGUUG -23
Get sequence
Star sequence

Sto-Mir-146-o1_3p* (predicted)

MirBase accessionNone
Sequence
42- GCCCAUGGUUCUCAGUUCUGCA -64
Get sequence