MirGeneDB

MirGeneDB ID

Sto-Mir-142-v4

Family name MIR-142 (all species)
Seed CCAUAAA
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-142-v1  Sto-Mir-142-v2  Sto-Mir-142-v3 
Orthologues Bta-Mir-142-v4  Cfa-Mir-142-v4  Cpo-Mir-142-v4  Dno-Mir-142-v4  Ete-Mir-142-v4  Hsa-Mir-142-v4  Mdo-Mir-142-v4  Mml-Mir-142-v4  Mmu-Mir-142-v4  Oan-Mir-142-v4  Ocu-Mir-142-v4  Rno-Mir-142-v4  Sha-Mir-142-v4 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01007505.1: 105405-105468 [-]
Precursor
(pre-Mir +30nt flank)
AAGAGGACCUAAUGAUAGACAGUGCAGUCAUCCAUAAAGUAGAAAGCACUACUAAACCAUUCAACCCAGUGUAGUGUUUCCUACUUUAUGGAUGAGUGCACUGUGAGCUUCUGAGAGAAGACAA
Get precursor sequence
Structure
        10          20        30        40        50        60 
AAGAGGACCUAAUGAUAG--|       G               A         UAAACCAU 
                    ACAGUGCA UCAUCCAUAAAGUAG AAGCACUAC        U
                    UGUCACGU AGUAGGUAUUUCAUC UUUGUGAUG        C
AACAGAAGAGAGUCUUCGAG^       G               C         UGACCCAA 
  120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
To
Mature sequence

Sto-Mir-142-v4_5p

MirBase accessionNone
Sequence
0- UCCAUAAAGUAGAAAGCACUAC -22
Get sequence
Star sequence

Sto-Mir-142-v4_3p*

MirBase accessionNone
Sequence
42- AGUGUUUCCUACUUUAUGGAUG -64
Get sequence