MirGeneDB

MirGeneDB ID

Sto-Mir-142-v2

Family name MIR-142 (all species)
Seed UAGUGUU
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-142-v1  Sto-Mir-142-v3  Sto-Mir-142-v4 
Orthologues Bta-Mir-142-v2  Cfa-Mir-142-v2  Cpo-Mir-142-v2  Dno-Mir-142-v2  Ete-Mir-142-v2  Hsa-Mir-142-v2  Mdo-Mir-142-v2  Mml-Mir-142-v2  Mmu-Mir-142-v2  Oan-Mir-142-v2  Ocu-Mir-142-v2  Rno-Mir-142-v2  Sha-Mir-142-v2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01007505.1: 105407-105466 [-]
Precursor
(pre-Mir +30nt flank)
GAGGACCUAAUGAUAGACAGUGCAGUCAUCCAUAAAGUAGAAAGCACUACUAAACCAUUCAACCCAGUGUAGUGUUUCCUACUUUAUGGAUGAGUGCACUGUGAGCUUCUGAGAGAAGAC
Get precursor sequence
Structure
        10          20        30        40        50         
GAGGACCUAAUGAUAGA--|      G               A         UAAACCAU 
                   CAGUGCA UCAUCCAUAAAGUAG AAGCACUAC        U
                   GUCACGU AGUAGGUAUUUCAUC UUUGUGAUG        C
CAGAAGAGAGUCUUCGAGU^      G               C         UGACCCAA 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Sto-Mir-142-v2_5p*

MirBase accessionNone
Sequence
0- CAUAAAGUAGAAAGCACUACUA -22
Get sequence
Mature sequence

Sto-Mir-142-v2_3p

MirBase accessionNone
Sequence
38- GUAGUGUUUCCUACUUUAUGGA -60
Get sequence