MirGeneDB

MirGeneDB ID

Sto-Mir-140-v2

Family name MIR-140 (all species)
Seed ACCACAG
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-140-v1 
Orthologues Aca-Mir-140-v2  Ami-Mir-140-v2  Bta-Mir-140-v2  Cfa-Mir-140-v2  Cli-Mir-140-v2  Cpi-Mir-140-v2  Cpo-Mir-140-v2  Dno-Mir-140-v2  Dre-Mir-140-v2  Ete-Mir-140-v2  Gga-Mir-140-v2  Hsa-Mir-140-v2  Mdo-Mir-140-v2  Mml-Mir-140-v2  Mmu-Mir-140-v2  Oan-Mir-140-v2  Ocu-Mir-140-v2  Rno-Mir-140-v2  Sha-Mir-140-v2  Tgu-Mir-140-v2  Xtr-Mir-140-v2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01000092.1: 252505-252566 [+]
Precursor
(pre-Mir +30nt flank)
UCCUGCAGCCUUUUUCACUCUGUGACCUACCAGUGGUUUUACCCUAUGGUAGGUUACGUCAUGCUGUUCUACCACAGGGUAGAACCACGGACAGGCUGCUGAGAAUCUUCCUGCAUCAGUGA
Get precursor sequence
Structure
        10          20         30        40        50        60
UCCUGCAGCCUUUUUCA--   U  GA   A-| A             A       UUACGU 
                   CUC GU  CCU  CC GUGGUUUUACCCU UGGUAGG      C
                   GAG CG  GGA  GG CACCAAGAUGGGA ACCAUCU      A
AGUGACUACGUCCUUCUAA   U  UC   CA^ -             C       UGUCGU 
120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
To
Star sequence

Sto-Mir-140-v2_5p*

MirBase accessionNone
Sequence
0- CAGUGGUUUUACCCUAUGGUAGG -23
Get sequence
Mature sequence

Sto-Mir-140-v2_3p

MirBase accessionNone
Sequence
39- UACCACAGGGUAGAACCACGGAC -62
Get sequence