MirGeneDB

MirGeneDB ID

Sto-Mir-140-v1

Family name MIR-140 (all species)
Seed CCACAGG
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-140-v2 
Orthologues Aca-Mir-140-v1  Ami-Mir-140-v1  Bta-Mir-140-v1  Cfa-Mir-140-v1  Cli-Mir-140-v1  Cpi-Mir-140-v1  Cpo-Mir-140-v1  Dno-Mir-140-v1  Dre-Mir-140-v1  Ete-Mir-140-v1  Gga-Mir-140-v1  Hsa-Mir-140-v1  Mdo-Mir-140-v1  Mml-Mir-140-v1  Mmu-Mir-140-v1  Oan-Mir-140-v1  Ocu-Mir-140-v1  Rno-Mir-140-v1  Sha-Mir-140-v1  Tgu-Mir-140-v1  Xtr-Mir-140-v1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01000092.1: 252505-252566 [+]
Precursor
(pre-Mir +30nt flank)
UCCUGCAGCCUUUUUCACUCUGUGACCUACCAGUGGUUUUACCCUAUGGUAGGUUACGUCAUGCUGUUCUACCACAGGGUAGAACCACGGACAGGCUGCUGAGAAUCUUCCUGCAUCAGUGA
Get precursor sequence
Structure
        10          20         30        40        50        60
UCCUGCAGCCUUUUUCA--   U  GA   A-| A             A      GUUACGU 
                   CUC GU  CCU  CC GUGGUUUUACCCU UGGUAG       C
                   GAG CG  GGA  GG CACCAAGAUGGGA ACCAUC       A
AGUGACUACGUCCUUCUAA   U  UC   CA^ -             C      UUGUCGU 
120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
To
Star sequence

Sto-Mir-140-v1_5p*

MirBase accessionNone
Sequence
0- CAGUGGUUUUACCCUAUGGUAG -22
Get sequence
Mature sequence

Sto-Mir-140-v1_3p

MirBase accessionNone
Sequence
40- ACCACAGGGUAGAACCACGGAC -62
Get sequence