MirGeneDB

MirGeneDB ID

Sto-Mir-135-P3

Family name MIR-135 (all species)
Seed AUGGCUU
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-135-P1  Sto-Mir-135-P2 
Orthologues Aca-Mir-135-P3  Ami-Mir-135-P3  Bta-Mir-135-P3  Cfa-Mir-135-P3  Cli-Mir-135-P3  Cpi-Mir-135-P3  Cpo-Mir-135-P3  Dno-Mir-135-P3  Dre-Mir-135-P3a  Dre-Mir-135-P3b  Ete-Mir-135-P3  Gga-Mir-135-P3  Hsa-Mir-135-P3  Mdo-Mir-135-P3  Mml-Mir-135-P3  Mmu-Mir-135-P3  Oan-Mir-135-P3  Ocu-Mir-135-P3  Rno-Mir-135-P3  Sha-Mir-135-P3  Tgu-Mir-135-P3  Xtr-Mir-135-P3 
Node of Origin (locus) Vertebrata
Node of Origin (family) Chordata
Genome context
(miRNA_loci_genome)
BFAA01000334.1: 138445-138504 [-]
Precursor
(pre-Mir +30nt flank)
UUUGGUGUGUGCAGAGUCGCUGCUGUGCCCUAUGGCUUUUUAUUCCUAUGUGAUAGUAUUUUGGCCUCACAUAGGGGUGAAAGCCAUGGGAUACAGGGUGAGAAACGCAUCUGCAAUUAC
Get precursor sequence
Structure
        10           20        30        40        50          
UUUGGUGUGUGCAGAGU---|   G     C            U            UAGUAU 
                    CGCU CUGUG CCUAUGGCUUUU AUUCCUAUGUGA      \
                    GUGG GACAU GGGUACCGAAAG UGGGGAUACACU      U
CAUUAACGUCUACGCAAAGA^   -     A            -            CCGGUU 
.       110       100         90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Sto-Mir-135-P3_5p

MirBase accessionNone
Sequence
0- UAUGGCUUUUUAUUCCUAUGUGA -23
Get sequence
Star sequence

Sto-Mir-135-P3_3p*

MirBase accessionNone
Sequence
38- ACAUAGGGGUGAAAGCCAUGGG -60
Get sequence