MirGeneDB

MirGeneDB ID

Sto-Mir-130-P4o1

Family name MIR-130 (all species)
Seed AGUGCAA
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-130-P1b  Sto-Mir-130-P2a  Sto-Mir-130-P2b  Sto-Mir-130-P3a  Sto-Mir-130-P3b  Sto-Mir-130-P4a  Sto-Mir-130-P4b 
Orthologues
Node of Origin (locus) S. torazame
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01048252.1: 939-1004 [-]
Precursor
(pre-Mir +30nt flank)
UUAGCCUGAAGCCUUUCCCGGUAGGCCGAGACCCUAUCAAUGUUGCCUCUGCUGUUCGGAUAUUCUCACAGUAGUGCAAUGUUGCUUAUAGGGUUCUGGACAGCGGGAGACCCUCGCGUCGGACAA
Get precursor sequence
Structure
        10          20        30           40        50        60 
UUAGCCUGAAGCCUUUC--  G  AGG   AG       ---|        CU     GUUCGGA 
                   CC GU   CCG  ACCCUAU   CAAUGUUGC  CUGCU       U
                   GG CG   GGU  UGGGAUA   GUUGUAACG  GAUGA       A
AACAGGCUGCGCUCCCAGA  G  ACA   CU       UUC^        U-     CACUCUU 
    120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Sto-Mir-130-P4o1_5p*

MirBase accessionNone
Sequence
0- ACCCUAUCAAUGUUGCCUCUGCU -23
Get sequence
Mature sequence

Sto-Mir-130-P4o1_3p

MirBase accessionNone
Sequence
41- UAGUGCAAUGUUGCUUAUAGGGUUC -66
Get sequence